SubtiBank SubtiBank
Version comparison:

2019-03-30 18:07:172025-05-28 14:40:45

locus

BSU00120

BSU_00120

outlinks

bsu

BSU00120

BSU_00120

The protein

Protein family

glutamine amidotransferase pdxT/SNO family (according to Swiss-Prot)

Glutaminase PdxT/SNO family (single member, according to UniProt)

Biological materials

Mutant

BKE00120 ([[gene|pdxT]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCAGCAGCGCTCCTAT, downstream forward: _UP4_TAAAACAGTTGAAAGCTGTG

BKK00120 ([[gene|pdxT]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCAGCAGCGCTCCTAT, downstream forward: _UP4_TAAAACAGTTGAAAGCTGTG

BV604 (([[gene|pdxS]]-[[gene|pdxT]])::tet), available in [SW|Fabian Commichau]'s lab, [Pubmed|24972371]

BKE00120 ([[gene|pdxT]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCAGCAGCGCTCCTAT, downstream forward: _UP4_TAAAACAGTTGAAAGCTGTG

BKK00120 ([[gene|pdxT]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCAGCAGCGCTCCTAT, downstream forward: _UP4_TAAAACAGTTGAAAGCTGTG

BV604 (([[gene|pdxS]]-[[gene|pdxT]])::tet), available in [SW|Fabian Commichau]'s lab, [Pubmed|24972371]

BP1100 (([[gene|pdxS]]-[[gene|pdxT]])::tet) trp+), available in [SW|Jörg Stülke]'s and [SW|Fabian Commichau]'s labs

BP1105 (([[gene|pdxT]])::cat) trp+), available in [SW|Jörg Stülke]'s and [SW|Fabian Commichau]'s labs

The protein

Catalyzed reaction/ biological activity

Catalyzes the hydrolysis of glutamine to glutamate and ammonia as part of the biosynthesis of pyridoxal 5'-phosphate. The resulting ammonia molecule is channeled to the active site of [[protein|PdxS]]. (according to UniProt)

aldehydo-D-ribose 5-phosphate + D-glyceraldehyde 3-phosphate + L-glutamine --> H+ + 3 H2O + L-glutamate + phosphate + pyridoxal 5'-phosphate (according to UniProt)

The protein

[SW|Localization]

cytosol (according to UniProt)

Biological materials

Expression vector

pBP767: IPTG inducible expression, purification in E. coli with cleaveable N-terminal His-tag, in petSUMOadapt, available in [SW|Fabian Commichau]'s and [SW|Jörg Stülke]'s labs

pBP772: expression of ''pdxST''-Strep by [SW|pGP382] in ''B. subtilis'' suitable for [SW|SPINE], available in [SW|Jörg Stülke]'s and [SW|Fabian Commichau]'s labs

pBP774: IPTG inducible expression and purification of ''pdxST'' in ''E. coli'' with C-terminal Strep-tag, in [SW|pGP574], available in [SW|Jörg Stülke]'s and [SW|Fabian Commichau]'s labs